View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF2137_low_35 (Length: 214)
Name: NF2137_low_35
Description: NF2137
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF2137_low_35 |
 |  |
|
Alignment Details
Target: chr1 (Bit Score: 110; Significance: 1e-55; HSPs: 1)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 110; E-Value: 1e-55
Query Start/End: Original strand, 14 - 198
Target Start/End: Complemental strand, 8458708 - 8458518
Alignment:
| Q |
14 |
cagagagtgaatcaagagcatgagtttaggattttaatcggaaaatgcaatgtgttattgccnnnnnnnnnnnnnnnnnngaaggtataagtaaaatgat |
113 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||| |
|
|
| T |
8458708 |
cagagagtgaatcaagagcatgagtttaggattttaatcggaaaatgcaatgtgttattgccaaaaaaattataaaaaaagaaggtataagtaaaatgat |
8458609 |
T |
 |
| Q |
114 |
gtagaagaaaatgtcatattcgcagtgggta------accttattaatcagtaacctttaaacctaaatatcccttctattccttaatatt |
198 |
Q |
| |
|
|||||||||||||||||||||||||||| || |||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
8458608 |
gtagaagaaaatgtcatattcgcagtggttaaaaggcaccttattaatcagtaacctttaaacctaaatatcccttctattccttaatatt |
8458518 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University