View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF21380_high_8 (Length: 247)
Name: NF21380_high_8
Description: NF21380
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF21380_high_8 |
 | |
|
Alignment Details
Target: chr1 (Bit Score: 217; Significance: 1e-119; HSPs: 1)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 217; E-Value: 1e-119
Query Start/End: Original strand, 16 - 232
Target Start/End: Complemental strand, 45685530 - 45685314
Alignment:
| Q |
16 |
ggtggtgattggaggagtggtcatgtcgaagactaggtgggctgagaggcccagatgggctaagcgcatgcagaaggctttgagcattaggccttcgcgg |
115 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
45685530 |
ggtggtgattggaggagtggtcatgtcgaagactaggtgggctgagaggcccagatgggctaagcgcatgcagaaggctttgagcattaggccttcgcgg |
45685431 |
T |
|
| Q |
116 |
ccaacaccgtagaggaaaacgcggccgttttgagaggagatggtggagagttcggttagtaagaggtcaagtggtggtgggtatggatgagtgggggttg |
215 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
45685430 |
ccaacaccgtagaggaaaacgcggccgttttgagaggagatggtggagagttcggttagtaagaggtcaagtggtggtgggtatggatgagtgggggttg |
45685331 |
T |
|
| Q |
216 |
aaaatatggaggatatt |
232 |
Q |
| |
|
||||||||||||||||| |
|
|
| T |
45685330 |
aaaatatggaggatatt |
45685314 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University