View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF21380_low_10 (Length: 235)
Name: NF21380_low_10
Description: NF21380
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF21380_low_10 |
 | |
|
Alignment Details
Target: chr7 (Bit Score: 158; Significance: 3e-84; HSPs: 1)
Name: chr7
Description:
Target: chr7; HSP #1
Raw Score: 158; E-Value: 3e-84
Query Start/End: Original strand, 15 - 172
Target Start/End: Complemental strand, 23063375 - 23063218
Alignment:
| Q |
15 |
aatatgtttgtgcaaattatgtacatcgaatgagtggcctaacaaaatgtcgacaaatagataggttacaagctggcaataagcagatgtgaaagaagct |
114 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
23063375 |
aatatgtttgtgcaaattatgtacatcgaatgagtggcctaacaaaatgtcgacaaatagataggttacaagctggcaataagcagatgtgaaagaagct |
23063276 |
T |
|
| Q |
115 |
taaaccaaagttgtatggtaatggtaagtggcaattaaggcagtcttttcttgggcac |
172 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
23063275 |
taaaccaaagttgtatggtaatggtaagtggcaattaaggcagtcttttcttgggcac |
23063218 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University