View Alignment

This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.

Legend
 Query
 Query hiting target  Query hiting target's complemental strand
 Query's complemental strand hiting target  Query's complemental strand hiting target's complemental strand

Alignment Overview

Query: NF21380_low_8 (Length: 247)

Name: NF21380_low_8
Description: NF21380
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)


[»] NF21380_low_8
NF21380_low_8
[»] chr1 (1 HSPs)
chr1 (16-232)||(45685314-45685530)


Alignment Details
Target: chr1 (Bit Score: 217; Significance: 1e-119; HSPs: 1)
Name: chr1
Description:

Target: chr1; HSP #1
Raw Score: 217; E-Value: 1e-119
Query Start/End: Original strand, 16 - 232
Target Start/End: Complemental strand, 45685530 - 45685314
Alignment:
16 ggtggtgattggaggagtggtcatgtcgaagactaggtgggctgagaggcccagatgggctaagcgcatgcagaaggctttgagcattaggccttcgcgg 115  Q
    ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||    
45685530 ggtggtgattggaggagtggtcatgtcgaagactaggtgggctgagaggcccagatgggctaagcgcatgcagaaggctttgagcattaggccttcgcgg 45685431  T
116 ccaacaccgtagaggaaaacgcggccgttttgagaggagatggtggagagttcggttagtaagaggtcaagtggtggtgggtatggatgagtgggggttg 215  Q
    ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||    
45685430 ccaacaccgtagaggaaaacgcggccgttttgagaggagatggtggagagttcggttagtaagaggtcaagtggtggtgggtatggatgagtgggggttg 45685331  T
216 aaaatatggaggatatt 232  Q
    |||||||||||||||||    
45685330 aaaatatggaggatatt 45685314  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]



© Oklahoma State University