View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF21382_high_19 (Length: 250)
Name: NF21382_high_19
Description: NF21382
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF21382_high_19 |
 |  |
|
| [»] chr3 (2 HSPs) |
 |  |
|
Alignment Details
Target: chr3 (Bit Score: 73; Significance: 2e-33; HSPs: 2)
Name: chr3
Description:
Target: chr3; HSP #1
Raw Score: 73; E-Value: 2e-33
Query Start/End: Original strand, 112 - 250
Target Start/End: Complemental strand, 26261214 - 26261073
Alignment:
| Q |
112 |
aatgtgtgaatcgattcacacaaactcactgttttgtgaga---nnnnnnnnnnnnngacaaactgttttgtgagaattgtttatctcattgatgcgaaa |
208 |
Q |
| |
|
||||| ||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||| |||||||||||||||| |
|
|
| T |
26261214 |
aatgtatgaatcgattcacacaaactcactgttttgtgagaatttttttttttttttgacaaactgttttgtgagaattgtttctctcattgatgcgaaa |
26261115 |
T |
 |
| Q |
209 |
tgtttcactctttttgttttacaaggattgtattaaaaaaca |
250 |
Q |
| |
|
||||||||| ||||||||||||||||| |||||||||||||| |
|
|
| T |
26261114 |
tgtttcactttttttgttttacaaggactgtattaaaaaaca |
26261073 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #2
Raw Score: 42; E-Value: 0.000000000000006
Query Start/End: Original strand, 6 - 55
Target Start/End: Complemental strand, 26261311 - 26261262
Alignment:
| Q |
6 |
ctccaataatatcaagatgacaatccatgttgaaatctcataattacatg |
55 |
Q |
| |
|
||||| |||||||||||||||||||||||||||||||||||| ||||||| |
|
|
| T |
26261311 |
ctccactaatatcaagatgacaatccatgttgaaatctcatacttacatg |
26261262 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University