View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF21382_high_24 (Length: 219)
Name: NF21382_high_24
Description: NF21382
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF21382_high_24 |
 | |
|
Alignment Details
Target: chr5 (Bit Score: 191; Significance: 1e-104; HSPs: 1)
Name: chr5
Description:
Target: chr5; HSP #1
Raw Score: 191; E-Value: 1e-104
Query Start/End: Original strand, 15 - 213
Target Start/End: Complemental strand, 34550040 - 34549842
Alignment:
| Q |
15 |
catcatccggtgcaaattttacatccatatactaaagagtggaaggctaagttggaagagatggagcttggttgtgatgctcctgatgacgcagatgatg |
114 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| | |||||||| |
|
|
| T |
34550040 |
catcatccggtgcaaattttacatccatatactaaagagtggaaggctaagttggaagagatggagcttggttgtgatgctcctgatgaagaagatgatg |
34549941 |
T |
|
| Q |
115 |
atattgttggtgataatgatactgagattatagattggattgaggatgaaggtagtgacggagatgctgaatttgatgatggtggtgaatttgatgatg |
213 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
34549940 |
atattgttggtgataatgatactgagattatagattggattgaggatgaaggtagtgacggagatgctgaatttgatgatggtggtgaatttgatgatg |
34549842 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University