View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF21382_low_16 (Length: 281)
Name: NF21382_low_16
Description: NF21382
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF21382_low_16 |
 | |
|
Alignment Details
Target: chr1 (Bit Score: 145; Significance: 2e-76; HSPs: 2)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 145; E-Value: 2e-76
Query Start/End: Original strand, 19 - 176
Target Start/End: Original strand, 32575343 - 32575502
Alignment:
| Q |
19 |
agacagagttcacagaaatggtgggcctagaactagaaatggtgactgtggtggttgggatgagggatgtccacttacagtattttacag--tatatttt |
116 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| | |||||||| |
|
|
| T |
32575343 |
agacagagttcacagaaatggtgggcctagaactagaaatggtgactgtggtggttgggatgagggatgtccacttacagtattttaccgtctatatttt |
32575442 |
T |
|
| Q |
117 |
agaaaaatataaacaagccatacaaaaggctgagtgcttgtcagtttatttagttactca |
176 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
32575443 |
agaaaaatataaacaagccatacaaaaggctgagtgcttgtcagtttatttagttactca |
32575502 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #2
Raw Score: 34; E-Value: 0.0000000004
Query Start/End: Original strand, 136 - 197
Target Start/End: Original strand, 32570356 - 32570416
Alignment:
| Q |
136 |
atacaaaaggctgagtgcttgtcagtttatttagttactcatgtttgtttatatctcatatt |
197 |
Q |
| |
|
||||||||||| |||||| |||||||| || |||||||||| |||||||| ||||||||||| |
|
|
| T |
32570356 |
atacaaaaggc-gagtgcatgtcagttgatctagttactcaggtttgtttgtatctcatatt |
32570416 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University