View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF21382_low_21 (Length: 250)
Name: NF21382_low_21
Description: NF21382
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF21382_low_21 |
 |  |
|
Alignment Details
Target: chr8 (Bit Score: 142; Significance: 1e-74; HSPs: 2)
Name: chr8
Description:
Target: chr8; HSP #1
Raw Score: 142; E-Value: 1e-74
Query Start/End: Original strand, 20 - 197
Target Start/End: Original strand, 10389960 - 10390137
Alignment:
| Q |
20 |
catttattgcatttcttctaaaacatagtggtgctacttcttctatcttggtcagatctccaaattctgaaggcttttctcttgcaggagattagggcac |
119 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||| |||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
10389960 |
catttattgcatttcttctaaaacatagtggtgctatttcttctatcttggccagatctccaaattctgaaggcttttctcttgcaggagattagggcac |
10390059 |
T |
 |
| Q |
120 |
caaatccatatcnnnnnnnnggtgatgatgatgtgaatatatagaaatgctagcttttgttttttcattcttaaacct |
197 |
Q |
| |
|
|||||||||||| ||||||||||||||||||||||||||||| |||||||||||||||||||||||||||| |
|
|
| T |
10390060 |
caaatccatatcttttttttggtgatgatgatgtgaatatatagaaatggtagcttttgttttttcattcttaaacct |
10390137 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #2
Raw Score: 37; E-Value: 0.000000000006
Query Start/End: Original strand, 197 - 249
Target Start/End: Complemental strand, 10390400 - 10390348
Alignment:
| Q |
197 |
tttcctttcttgtttcgtcaattactgcacccgaggcactaaaaattacaaat |
249 |
Q |
| |
|
|||||||| ||||||| |||||||||||| |||| |||||||||||||||||| |
|
|
| T |
10390400 |
tttccttttttgtttcatcaattactgcatccgatgcactaaaaattacaaat |
10390348 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University