View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF21383_high_12 (Length: 331)
Name: NF21383_high_12
Description: NF21383
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF21383_high_12 |
 |  |
|
Alignment Details
Target: chr2 (Bit Score: 142; Significance: 2e-74; HSPs: 2)
Name: chr2
Description:
Target: chr2; HSP #1
Raw Score: 142; E-Value: 2e-74
Query Start/End: Original strand, 154 - 314
Target Start/End: Complemental strand, 6307689 - 6307524
Alignment:
| Q |
154 |
cggttttggcaaattttaatgattatgttatatattttgatttaatcaaataataaagaggtgtaatattagaagaagaaaccctagaatgcatgcaaat |
253 |
Q |
| |
|
|||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
6307689 |
cggttttggcaaattttaatcattatgttatatattttgatttaatcaaataataaagaggtgtaatattagaagaagaaaccctagaatgcatgcaaat |
6307590 |
T |
 |
| Q |
254 |
aagaggatggaaatttttattttgaatacctgatagg-----tatgaatctaattgacattgtaga |
314 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||| |
|
|
| T |
6307589 |
aagaggatggaaatttttattttgaatacctgataggtatggtatgaatctaattgacattgtaga |
6307524 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #2
Raw Score: 75; E-Value: 2e-34
Query Start/End: Original strand, 18 - 92
Target Start/End: Complemental strand, 6307825 - 6307751
Alignment:
| Q |
18 |
cataaactatgtcgacaattaaactagacaggataagatactgatttaagacctgggctatgtttagatattttg |
92 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
6307825 |
cataaactatgtcgacaattaaactagacaggataagatactgatttaagacctgggctatgtttagatattttg |
6307751 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University