View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF21383_high_24 (Length: 238)
Name: NF21383_high_24
Description: NF21383
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF21383_high_24 |
 |  |
|
Alignment Details
Target: chr8 (Bit Score: 197; Significance: 1e-107; HSPs: 1)
Name: chr8
Description:
Target: chr8; HSP #1
Raw Score: 197; E-Value: 1e-107
Query Start/End: Original strand, 20 - 224
Target Start/End: Original strand, 931194 - 931398
Alignment:
| Q |
20 |
ccctgacttggagataaagagccaattggagaatataaacgcccctgcattttcggaactaaatgttcttgagcctatggaaaacggtgaggctgatgat |
119 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||| |
|
|
| T |
931194 |
ccctgacttggagataaagagccaattggagaatataaacgcccctgcattttcggaactaaatgttcttgagcctagggaaaacggtgaggctgatgat |
931293 |
T |
 |
| Q |
120 |
tgtgtccgggaaatgatgtcaattgaacaaactcctctgtgtaagggagataaggatgtagaagttaatatcactgagtgcaaaaattctggcaaagctt |
219 |
Q |
| |
|
|||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
931294 |
tgtgcccgggaaatgatgtcaattgaacaaactcctctgtgtaagggagataaggatgtagaagttaatatcactgagtgcaaaaattctggcaaagctt |
931393 |
T |
 |
| Q |
220 |
tgatg |
224 |
Q |
| |
|
||||| |
|
|
| T |
931394 |
tgatg |
931398 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University