View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF21383_low_15 (Length: 312)
Name: NF21383_low_15
Description: NF21383
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF21383_low_15 |
 | |
|
Alignment Details
Target: chr4 (Bit Score: 176; Significance: 8e-95; HSPs: 2)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 176; E-Value: 8e-95
Query Start/End: Original strand, 19 - 227
Target Start/End: Original strand, 48289321 - 48289537
Alignment:
| Q |
19 |
gacttcagctcccacattcaacacatgtcaacctcaggattcttggaccacaaaccttgtattgtacctgcatgcgtgtttgctgcatttcggactgcgg |
118 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
48289321 |
gacttcagctcccacattcaacacatgtcaacctcaggattcttggaccacaaaccttgtattgtacctgcatgcgtgtttgctgcatttcggactgcgg |
48289420 |
T |
|
| Q |
119 |
gccgtaggatggatggaagtcattcagggtggcgtgggcc--------ctgcatgcttagactcttctccgggtagcactctggtgacataaaattgatg |
210 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||| | |||||||||||||||||||||||||||||||||||||||||||||||| ||| |
|
|
| T |
48289421 |
gccgtaggatggatggaagtcattcagggtggcgtggggcctgcatggctgcatgcttagactcttctccgggtagcactctggtgacataaaatttatg |
48289520 |
T |
|
| Q |
211 |
acatcgatcaatcacaa |
227 |
Q |
| |
|
|||||||| |||||||| |
|
|
| T |
48289521 |
acatcgattaatcacaa |
48289537 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #2
Raw Score: 34; E-Value: 0.0000000004
Query Start/End: Original strand, 243 - 304
Target Start/End: Original strand, 48289559 - 48289619
Alignment:
| Q |
243 |
cttctctttttcataacgattgtgacattgtaatatcaccccaagtgttatcttcttcttct |
304 |
Q |
| |
|
|||||||||||||||| |||||||||||| | |||||| |||||||| |||| ||||||||| |
|
|
| T |
48289559 |
cttctctttttcataaggattgtgacattatgatatca-cccaagtgctatcctcttcttct |
48289619 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University