View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF21383_low_20 (Length: 261)
Name: NF21383_low_20
Description: NF21383
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF21383_low_20 |
 |  |
|
Alignment Details
Target: chr6 (Bit Score: 149; Significance: 9e-79; HSPs: 1)
Name: chr6
Description:
Target: chr6; HSP #1
Raw Score: 149; E-Value: 9e-79
Query Start/End: Original strand, 18 - 189
Target Start/End: Original strand, 31972586 - 31972759
Alignment:
| Q |
18 |
ccaagtgcctcctcaagttgcaatgggaatgactcgctagaatttgcttattttctat---gattgatttattatgttgttgtttttcaagatcttatta |
114 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||| ||||||||||||| |||||||| |||||||||||||||||||||||||||||| |
|
|
| T |
31972586 |
ccaagtgcctcctcaagttgcaatgggaatgactcgctagaatt-gcttattttctattatgattgattcattatgttgttgtttttcaagatcttatta |
31972684 |
T |
 |
| Q |
115 |
caaagagtgcttaatttgttgtttccttttgttatgttctatttgttgtaattgagagctactagatatgttctc |
189 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
31972685 |
caaagagtgcttaatttgttgtttccttttgttatgttctatttgttgtaattgagagctactagatatgttctc |
31972759 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University