View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF21383_low_22 (Length: 246)
Name: NF21383_low_22
Description: NF21383
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF21383_low_22 |
 | |
|
| [»] chr3 (1 HSPs) |
| |
|
Alignment Details
Target: chr3 (Bit Score: 199; Significance: 1e-108; HSPs: 1)
Name: chr3
Description:
Target: chr3; HSP #1
Raw Score: 199; E-Value: 1e-108
Query Start/End: Original strand, 17 - 246
Target Start/End: Original strand, 27679405 - 27679635
Alignment:
| Q |
17 |
agatcttaactccaactaccgtggaccgccttcatatgtggttcatatgaactagtacttgaaaattgtccaaaacaccgattacaactgatgttaccgt |
116 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
27679405 |
agatcttaactccaactaccgtggaccgccttcatatgtggttcatatgaactaccacttgaaaattgtccaaaacaccgattacaactgatgttaccgt |
27679504 |
T |
|
| Q |
117 |
tcaaaagtagaagctcgtaatcccctttctcctcacaattgaga-aggcgagtttatcgatgccaattttataataacaaagaaaacaaatgagttaagt |
215 |
Q |
| |
|
||||||||||||||||||| ||||||||||| |||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
27679505 |
tcaaaagtagaagctcgtagtcccctttctcttcacaattgagacgggcgagtttatcgatgccaattttataataacaaagaaaacaaatgagttaagt |
27679604 |
T |
|
| Q |
216 |
tttgaggagcattattttgtttttcttgttt |
246 |
Q |
| |
|
|||||||||||||||||||||| |||||||| |
|
|
| T |
27679605 |
tttgaggagcattattttgtttgtcttgttt |
27679635 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University