View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF21383_low_25 (Length: 229)
Name: NF21383_low_25
Description: NF21383
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF21383_low_25 |
 | |
|
Alignment Details
Target: chr3 (Bit Score: 158; Significance: 3e-84; HSPs: 2)
Name: chr3
Description:
Target: chr3; HSP #1
Raw Score: 158; E-Value: 3e-84
Query Start/End: Original strand, 20 - 213
Target Start/End: Complemental strand, 27815258 - 27815065
Alignment:
| Q |
20 |
attatgtaaattggttacaggattgtgcggatgaagatgatatgttttataataaacaaattgttccatgcttttcgtcacaacttgagatgtttgatca |
119 |
Q |
| |
|
||||| |||| || ||| ||||||||| ||||||||||||||||||| ||||||||||||| ||||||||| |||||||||||||||||||||||||||| |
|
|
| T |
27815258 |
attatttaaaatgtttagaggattgtgtggatgaagatgatatgtttgataataaacaaatagttccatgcgtttcgtcacaacttgagatgtttgatca |
27815159 |
T |
|
| Q |
120 |
acaaactgttccatcatgcctttcatcacaacttaaaacatgttgccttaaagattacaaaggaacgaaaaatgagcttcgatttgcaacatat |
213 |
Q |
| |
|
||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
27815158 |
acaaattgttccatcatgcctttcatcacaacttaaaacatgttgccttaaagattacaaaggaacgaaaaatgagcttcgatttgcaacatat |
27815065 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #2
Raw Score: 57; E-Value: 6e-24
Query Start/End: Original strand, 1 - 57
Target Start/End: Complemental strand, 27815322 - 27815266
Alignment:
| Q |
1 |
ataataataataatcaataattatgtaaattggttacaggattgtgcggatgaagat |
57 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
27815322 |
ataataataataatcaataattatgtaaattggttacaggattgtgcggatgaagat |
27815266 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University