View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF21383_low_9 (Length: 417)
Name: NF21383_low_9
Description: NF21383
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF21383_low_9 |
 |  |
|
| [»] scaffold0010 (1 HSPs) |
 |  |  |
|
Alignment Details
Target: chr4 (Bit Score: 152; Significance: 2e-80; HSPs: 2)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 152; E-Value: 2e-80
Query Start/End: Original strand, 250 - 401
Target Start/End: Original strand, 36064406 - 36064557
Alignment:
| Q |
250 |
gtgaaattgctaagcagatgcattttgagttcagtactccaaagaaaagcagtgttgctgttagatcaccatttgatattgaaaatgggtttgatgatga |
349 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
36064406 |
gtgaaattgctaagcagatgcattttgagttcagtactccaaagaaaagcagtgttgctgttagatcaccatttgatattgaaaatgggtttgatgatga |
36064505 |
T |
 |
| Q |
350 |
aattgaagctccaaatgcacctttgatgtcgaagaaatcgaagccaaggttg |
401 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
36064506 |
aattgaagctccaaatgcacctttgatgtcgaagaaatcgaagccaaggttg |
36064557 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #2
Raw Score: 101; E-Value: 6e-50
Query Start/End: Original strand, 1 - 105
Target Start/End: Original strand, 36064174 - 36064278
Alignment:
| Q |
1 |
aggttagggttttatgtggtgtggatcatgatgatttggaacagctttttaatgtatctacaacgattagagaagcagtaagtgttattctatataaatc |
100 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||| |
|
|
| T |
36064174 |
aggttagggttttatgtggtgtggatcatgatgatttggaacagctttttaatgtatctacaacgattaaagaagcagtaagtgttattctatataaatc |
36064273 |
T |
 |
| Q |
101 |
aattt |
105 |
Q |
| |
|
||||| |
|
|
| T |
36064274 |
aattt |
36064278 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: scaffold0010 (Bit Score: 29; Significance: 0.0000006; HSPs: 1)
Name: scaffold0010
Description:
Target: scaffold0010; HSP #1
Raw Score: 29; E-Value: 0.0000006
Query Start/End: Original strand, 316 - 368
Target Start/End: Original strand, 156844 - 156896
Alignment:
| Q |
316 |
caccatttgatattgaaaatgggtttgatgatgaaattgaagctccaaatgca |
368 |
Q |
| |
|
|||| |||||||| |||||||||||||| |||||||||||||| ||| |||| |
|
|
| T |
156844 |
caccttttgatatacaaaatgggtttgataatgaaattgaagctacaattgca |
156896 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University