View Alignment

This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.

Legend
 Query
 Query hiting target  Query hiting target's complemental strand
 Query's complemental strand hiting target  Query's complemental strand hiting target's complemental strand

Alignment Overview

Query: NF21384_high_6 (Length: 224)

Name: NF21384_high_6
Description: NF21384
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)


[»] NF21384_high_6
NF21384_high_6
[»] chr7 (3 HSPs)
chr7 (65-137)||(40766194-40766266)
chr7 (159-224)||(40766358-40766423)
chr7 (1-72)||(40766303-40766375)


Alignment Details
Target: chr7 (Bit Score: 65; Significance: 1e-28; HSPs: 3)
Name: chr7
Description:

Target: chr7; HSP #1
Raw Score: 65; E-Value: 1e-28
Query Start/End: Original strand, 65 - 137
Target Start/End: Complemental strand, 40766266 - 40766194
Alignment:
65 ttctcccactagattaaggatttacatagtttttaaaatttcgttgcttgccgaaaggaattaagctattgca 137  Q
    ||||||||||||| |||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||    
40766266 ttctcccactagactaaggatttacatagtttttgaaatttcgttgcttgccgaaaggaattaagctattgca 40766194  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr7; HSP #2
Raw Score: 58; E-Value: 1e-24
Query Start/End: Original strand, 159 - 224
Target Start/End: Complemental strand, 40766423 - 40766358
Alignment:
159 gtgtggatgatatggaagagacggaacaagaagatttgggaaaacatcgagaaaactttgctatgc 224  Q
    ||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||| ||||||    
40766423 gtgtggatgatatggaagagacggaacaagaagatttgggaaaacattgagaaaactttactatgc 40766358  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr7; HSP #3
Raw Score: 57; E-Value: 6e-24
Query Start/End: Original strand, 1 - 72
Target Start/End: Complemental strand, 40766375 - 40766303
Alignment:
1 gagaaaactttgctatgcttgtgtggatgtgcctttt-caactcaaaaaatcattgccgtcaaacttctccca 72  Q
    ||||||||||| ||||||||||||||||||||||||| |||||||||||||||||||||||||||||| ||||    
40766375 gagaaaactttactatgcttgtgtggatgtgcctttttcaactcaaaaaatcattgccgtcaaacttcaccca 40766303  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]



© Oklahoma State University