View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF21384_low_2 (Length: 452)
Name: NF21384_low_2
Description: NF21384
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF21384_low_2 |
 | |
|
Alignment Details
Target: chr4 (Bit Score: 224; Significance: 1e-123; HSPs: 1)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 224; E-Value: 1e-123
Query Start/End: Original strand, 1 - 248
Target Start/End: Complemental strand, 2656609 - 2656362
Alignment:
| Q |
1 |
ttgtctaaggatttgctaaagacaaaaaggatgacgattgaaaatttgattgaatcatctgaggtggtttatttatgtctcttatatgttaataagtttc |
100 |
Q |
| |
|
|||||| ||||||| |||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
2656609 |
ttgtctgaggatttcctaaagacgaaaaggatgacgattgaaaatttgattgaatcatctgaggtggtttatttatgtctcttatatgttaataagtttc |
2656510 |
T |
|
| Q |
101 |
aatttaaaatagacagttgaacaagtggaccaaataatcattactaattgatgatcattattatgcaggtatgtcaaggatttgttcttgcaactatatg |
200 |
Q |
| |
|
||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
2656509 |
aatttaaaatagacagttgaacaagtggaccaaatgatcattactaattgatgatcattattatgcaggtatgtcaaggatttgttcttgcaactatatg |
2656410 |
T |
|
| Q |
201 |
tgaacctgagaccagtttgaaatggtactttcgttcatgtacctagtg |
248 |
Q |
| |
|
||||||||||||||||||| ||||||||||||||||||||||| |||| |
|
|
| T |
2656409 |
tgaacctgagaccagtttggaatggtactttcgttcatgtacccagtg |
2656362 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University