View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF21384_low_7 (Length: 224)
Name: NF21384_low_7
Description: NF21384
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF21384_low_7 |
 | |
|
Alignment Details
Target: chr7 (Bit Score: 65; Significance: 1e-28; HSPs: 3)
Name: chr7
Description:
Target: chr7; HSP #1
Raw Score: 65; E-Value: 1e-28
Query Start/End: Original strand, 65 - 137
Target Start/End: Complemental strand, 40766266 - 40766194
Alignment:
| Q |
65 |
ttctcccactagattaaggatttacatagtttttaaaatttcgttgcttgccgaaaggaattaagctattgca |
137 |
Q |
| |
|
||||||||||||| |||||||||||||||||||| |||||||||||||||||||||||||||||||||||||| |
|
|
| T |
40766266 |
ttctcccactagactaaggatttacatagtttttgaaatttcgttgcttgccgaaaggaattaagctattgca |
40766194 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #2
Raw Score: 58; E-Value: 1e-24
Query Start/End: Original strand, 159 - 224
Target Start/End: Complemental strand, 40766423 - 40766358
Alignment:
| Q |
159 |
gtgtggatgatatggaagagacggaacaagaagatttgggaaaacatcgagaaaactttgctatgc |
224 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||| |||||| |
|
|
| T |
40766423 |
gtgtggatgatatggaagagacggaacaagaagatttgggaaaacattgagaaaactttactatgc |
40766358 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #3
Raw Score: 57; E-Value: 6e-24
Query Start/End: Original strand, 1 - 72
Target Start/End: Complemental strand, 40766375 - 40766303
Alignment:
| Q |
1 |
gagaaaactttgctatgcttgtgtggatgtgcctttt-caactcaaaaaatcattgccgtcaaacttctccca |
72 |
Q |
| |
|
||||||||||| ||||||||||||||||||||||||| |||||||||||||||||||||||||||||| |||| |
|
|
| T |
40766375 |
gagaaaactttactatgcttgtgtggatgtgcctttttcaactcaaaaaatcattgccgtcaaacttcaccca |
40766303 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University