View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF21385_low_15 (Length: 220)
Name: NF21385_low_15
Description: NF21385
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF21385_low_15 |
 | |
|
Alignment Details
Target: chr8 (Bit Score: 77; Significance: 7e-36; HSPs: 2)
Name: chr8
Description:
Target: chr8; HSP #1
Raw Score: 77; E-Value: 7e-36
Query Start/End: Original strand, 18 - 132
Target Start/End: Original strand, 505807 - 505913
Alignment:
| Q |
18 |
ccatgttgatatgtttctccattgtaagtaaactagagagtttgattaggacttgttgggagtacacaatgagtgaagggtgcttaaaaataaataaata |
117 |
Q |
| |
|
||||||||||||||||||||||||||| ||||||||||||||||| |||||||||||||||||||||||||||||||||||||| ||||||||| |
|
|
| T |
505807 |
ccatgttgatatgtttctccattgtaa----actagagagtttgattatgacttgttgggagtacacaatgagtgaagggtgcttaa----aaataaata |
505898 |
T |
|
| Q |
118 |
gacttggctttatgg |
132 |
Q |
| |
|
||||||||||||||| |
|
|
| T |
505899 |
gacttggctttatgg |
505913 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #2
Raw Score: 35; E-Value: 0.00000000008
Query Start/End: Original strand, 171 - 205
Target Start/End: Original strand, 506282 - 506316
Alignment:
| Q |
171 |
ttaaattctacatagataaccattacttacctttg |
205 |
Q |
| |
|
||||||||||||||||||||||||||||||||||| |
|
|
| T |
506282 |
ttaaattctacatagataaccattacttacctttg |
506316 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University