View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF21385_low_6 (Length: 444)
Name: NF21385_low_6
Description: NF21385
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF21385_low_6 |
 |  |
|
Alignment Details
Target: chr4 (Bit Score: 243; Significance: 1e-134; HSPs: 4)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 243; E-Value: 1e-134
Query Start/End: Original strand, 71 - 426
Target Start/End: Original strand, 19425656 - 19425997
Alignment:
| Q |
71 |
tttcagcatccagctttctgtcttaaacccttttaggatatcatggagtttgtcaaaattttaagtttcacatttctcttgtttattggatgtacttcgg |
170 |
Q |
| |
|
||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| || |
|
|
| T |
19425656 |
tttcagcatccagatttctgtcttaaacccttttaggatatcatggagtttgtcaaaattttaagtttcacatttctcttgtttattggatgtactttgg |
19425755 |
T |
 |
| Q |
171 |
tgaatggatccaccccaaaggtaagaactattctgaaaggtgatattgctcaattattacaagttgaaaataacttacgtacatattacaagttgtttct |
270 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||| |
|
|
| T |
19425756 |
tgaatggatccaccccaaaggtaagaactattctgaaaggtgatattgctcaattattacaagttgaaaataatttacgtacatattacaagttgtttct |
19425855 |
T |
 |
| Q |
271 |
aaacaatctcagacaagtgcttgatgcatgtcgtgtacgtaagctgcatgcatctatagcctgtgagctatatcttatattgctgtatgcggcagcttta |
370 |
Q |
| |
|
||||||||||||||||||||||||||||||| |||||||||||||||||||||||||| | ||| |||| |||||||| ||||||| |
|
|
| T |
19425856 |
aaacaatctcagacaagtgcttgatgcatgttgtgtacgtaagctgcatgcatctata---ttgctgct----------ttgc-gtatgcgggagcttta |
19425941 |
T |
 |
| Q |
371 |
gtacactggactgccctttatgatagtatgttgtcagttttaaatcgtgtcacaat |
426 |
Q |
| |
|
|||||| ||| |||||||||||||||||||||||| |||| ||||| ||||||||| |
|
|
| T |
19425942 |
gtacaccggattgccctttatgatagtatgttgtctgtttcaaatcatgtcacaat |
19425997 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #2
Raw Score: 99; E-Value: 1e-48
Query Start/End: Original strand, 71 - 209
Target Start/End: Original strand, 19418910 - 19419048
Alignment:
| Q |
71 |
tttcagcatccagctttctgtcttaaacccttttaggatatcatggagtttgtcaaaattttaagtttcacatttctcttgtttattggatgtacttcgg |
170 |
Q |
| |
|
|||||||||||||||||||||| || |||||||||| |||||||||||| ||||||| ||||||||||||||||||||||||||||||||| ||||| || |
|
|
| T |
19418910 |
tttcagcatccagctttctgtcctagacccttttagcatatcatggagtctgtcaaacttttaagtttcacatttctcttgtttattggatatactttgg |
19419009 |
T |
 |
| Q |
171 |
tgaatggatccaccccaaaggtaagaactattctgaaag |
209 |
Q |
| |
|
||||||||||||| ||||||||||| |||||||| |||| |
|
|
| T |
19419010 |
tgaatggatccactccaaaggtaagtactattctcaaag |
19419048 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #3
Raw Score: 62; E-Value: 1e-26
Query Start/End: Original strand, 1 - 74
Target Start/End: Complemental strand, 19425195 - 19425123
Alignment:
| Q |
1 |
gttaaaacaatcattggtcaggtttttatttaactatgttcctattcgtctccgtaatagatgacataattttc |
74 |
Q |
| |
|
||||||||||||||||||| |||||| ||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
19425195 |
gttaaaacaatcattggtcgggtttt-atttaactatgttcctattcgtctccgtaatagatgacataattttc |
19425123 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #4
Raw Score: 53; E-Value: 3e-21
Query Start/End: Original strand, 283 - 355
Target Start/End: Original strand, 19419194 - 19419266
Alignment:
| Q |
283 |
acaagtgcttgatgcatgtcgtgtacgtaagctgcatgcatctatagcctgtgagctatatcttatattgctg |
355 |
Q |
| |
|
||||||| ||||||||||| || |||||||| |||||||||||||||||| |||||||||||||||||||||| |
|
|
| T |
19419194 |
acaagtgtttgatgcatgttgtttacgtaagttgcatgcatctatagcctttgagctatatcttatattgctg |
19419266 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University