View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF21386_high_4 (Length: 216)
Name: NF21386_high_4
Description: NF21386
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF21386_high_4 |
 | |
|
| [»] chr4 (1 HSPs) |
| |
|
Alignment Details
Target: chr4 (Bit Score: 166; Significance: 5e-89; HSPs: 1)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 166; E-Value: 5e-89
Query Start/End: Original strand, 18 - 216
Target Start/End: Complemental strand, 33887260 - 33887056
Alignment:
| Q |
18 |
ttcagggaagaggagattgatgaattctttgcaaattttgagagggaagagcggaagagatttgctgagaagtaagaatataataaaactaccacctgct |
117 |
Q |
| |
|
|||||||| | ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||| |
|
|
| T |
33887260 |
ttcagggaggcggagattgatgaattctttgcaaattttgagagggaagagcggaagagatttgctgagaagtaagtatataataaaactaccacctgct |
33887161 |
T |
|
| Q |
118 |
ataaattattttaacttttattttgaaatgagtgacacaagatacggaatgtgagcagtgatctattccctgtcc------ctgtgcagtggcagaatca |
211 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||| ||||||||||||||||||| |
|
|
| T |
33887160 |
ataaattattttaacttttattttgaaatgagtgacacaagataaggaatgtgagcagtgatctattccctgtccctgtccctgtgcagtggcagaatca |
33887061 |
T |
|
| Q |
212 |
aaccc |
216 |
Q |
| |
|
||||| |
|
|
| T |
33887060 |
aaccc |
33887056 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University