View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF21386_low_5 (Length: 259)
Name: NF21386_low_5
Description: NF21386
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF21386_low_5 |
 |  |
|
Alignment Details
Target: chr7 (Bit Score: 184; Significance: 1e-99; HSPs: 1)
Name: chr7
Description:
Target: chr7; HSP #1
Raw Score: 184; E-Value: 1e-99
Query Start/End: Original strand, 25 - 243
Target Start/End: Original strand, 48892912 - 48893133
Alignment:
| Q |
25 |
gtgtcagaaaaaggacacacaaatccgagtagtgctcatg---gtatttgataaaattaaaagacaatgaaggaataaagaaattaaattaccagctctt |
121 |
Q |
| |
|
|||||||| | ||||||||||||||||||||||| || || ||| ||||||||||||||||||||| ||||||||||||||||||||||||||||||| |
|
|
| T |
48892912 |
gtgtcagacacaggacacacaaatccgagtagtgttcgtgattgtaattgataaaattaaaagacaattaaggaataaagaaattaaattaccagctctt |
48893011 |
T |
 |
| Q |
122 |
tttggaagtgatctccattggccttctccatgagcttgaatatatttggtgagcaatgcatcttcacgagaagtccatggacctctatgcaacccaactt |
221 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
48893012 |
tttggaagtgatctccattggccttctccatgagcttgaatatatttggtgagcaatgcatcttcacgagaagtccatggacctctatgcaacccaactt |
48893111 |
T |
 |
| Q |
222 |
ttgaacaacaaggagttcttcc |
243 |
Q |
| |
|
|||||||||||||||||||||| |
|
|
| T |
48893112 |
ttgaacaacaaggagttcttcc |
48893133 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8 (Bit Score: 62; Significance: 7e-27; HSPs: 1)
Name: chr8
Description:
Target: chr8; HSP #1
Raw Score: 62; E-Value: 7e-27
Query Start/End: Original strand, 110 - 243
Target Start/End: Complemental strand, 9621484 - 9621351
Alignment:
| Q |
110 |
ttaccagctctttttggaagtgatctccattggccttctccatgagcttgaatatatttggtgagcaatgcatcttcacgagaagtccatggacctctat |
209 |
Q |
| |
|
||||||||| |||| ||||||||| ||||||||||||| ||||||||||||| |||||| || |||||||||||||| || |||||||||||| | | |
|
|
| T |
9621484 |
ttaccagcttttttaggaagtgatttccattggccttcaccatgagcttgaacatattttgtaagcaatgcatcttctttagtagtccatggacccttgt |
9621385 |
T |
 |
| Q |
210 |
gcaacccaacttttgaacaacaaggagttcttcc |
243 |
Q |
| |
|
|||| |||||||| | ||||||||||| |||||| |
|
|
| T |
9621384 |
gcaatccaactttggcacaacaaggagctcttcc |
9621351 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University