View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF21386_low_6 (Length: 239)
Name: NF21386_low_6
Description: NF21386
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF21386_low_6 |
 |  |
|
Alignment Details
Target: chr3 (Bit Score: 206; Significance: 1e-113; HSPs: 1)
Name: chr3
Description:
Target: chr3; HSP #1
Raw Score: 206; E-Value: 1e-113
Query Start/End: Original strand, 1 - 222
Target Start/End: Complemental strand, 55301265 - 55301044
Alignment:
| Q |
1 |
tatttggttgcccacagatactcatacatacttcctgcctcagccgtgttcatcgacttatgctcacaaggtaattccattgacactgtttgttcagaag |
100 |
Q |
| |
|
|||||||||||||||||||||||||||||| ||||| || |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
55301265 |
tatttggttgcccacagatactcatacatatttccttccacagccgtgttcatcgacttatgctcacaaggtaattccattgacactgtttgttcagaag |
55301166 |
T |
 |
| Q |
101 |
cagtcttttgaccacccaaccaaaagtctctgagttcctctttcaaatctgttgtctctgtatttattagtacattctcattcccaacttgtgacgcacg |
200 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
55301165 |
cagtcttttgaccacccaaccaaaagtctctgagttcctctttcaaacctgttgtctctgtatttattagtacattctcattcccaacttgtgacgcacg |
55301066 |
T |
 |
| Q |
201 |
actctctctcaatggcttctct |
222 |
Q |
| |
|
|||||||||||||||||||||| |
|
|
| T |
55301065 |
actctctctcaatggcttctct |
55301044 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University