View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF21386_low_8 (Length: 204)
Name: NF21386_low_8
Description: NF21386
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF21386_low_8 |
 | |
|
Alignment Details
Target: chr3 (Bit Score: 103; Significance: 2e-51; HSPs: 1)
Name: chr3
Description:
Target: chr3; HSP #1
Raw Score: 103; E-Value: 2e-51
Query Start/End: Original strand, 1 - 119
Target Start/End: Complemental strand, 26461799 - 26461681
Alignment:
| Q |
1 |
atttggttgtagatttcgggttcattgaggatagagagcggggtggttgatgaggtaacggagagtgttggattgacgatggtgcaaagggattggaggg |
100 |
Q |
| |
|
||||||||||||||||||||||| |||||||||||||| ||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||| | |
|
|
| T |
26461799 |
atttggttgtagatttcgggttcgttgaggatagagagaggggtggttgatgaggtaatggagagtgttggattgacgatggtgcaaagggattggagag |
26461700 |
T |
|
| Q |
101 |
cggattggattttatctaa |
119 |
Q |
| |
|
||||||||||||||||||| |
|
|
| T |
26461699 |
cggattggattttatctaa |
26461681 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5 (Bit Score: 77; Significance: 6e-36; HSPs: 1)
Name: chr5
Description:
Target: chr5; HSP #1
Raw Score: 77; E-Value: 6e-36
Query Start/End: Original strand, 1 - 117
Target Start/End: Original strand, 38006014 - 38006130
Alignment:
| Q |
1 |
atttggttgtagatttcgggttcattgaggatagagagcggggtggttgatgaggtaacggagagtgttggattgacgatggtgcaaagggattggaggg |
100 |
Q |
| |
|
|||||||||||||||| | |||| |||||||||||||| |||||||||||||| |||| |||||||||||| |||||||||||||||||||||||||| | |
|
|
| T |
38006014 |
atttggttgtagattttgagttcgttgaggatagagagaggggtggttgatgatgtaatggagagtgttgggttgacgatggtgcaaagggattggagtg |
38006113 |
T |
|
| Q |
101 |
cggattggattttatct |
117 |
Q |
| |
|
| |||||||||||||| |
|
|
| T |
38006114 |
caaattggattttatct |
38006130 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University