View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF21388_low_18 (Length: 236)
Name: NF21388_low_18
Description: NF21388
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF21388_low_18 |
 | |
|
Alignment Details
Target: chr2 (Bit Score: 194; Significance: 1e-105; HSPs: 1)
Name: chr2
Description:
Target: chr2; HSP #1
Raw Score: 194; E-Value: 1e-105
Query Start/End: Original strand, 19 - 220
Target Start/End: Original strand, 41263849 - 41264050
Alignment:
| Q |
19 |
atcaatgaacagtattagcatcacaattacagatgaaagtgtcgaaaatatgcatatggaagatcactttgagtgaagatattttgattaccgtgtaata |
118 |
Q |
| |
|
||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
41263849 |
atcaatgaacagtattagcatcacaattatagatgaaagtgtcgaaaatatgcatatggaagatcactttgagtgaagatattttgattaccgtgtaata |
41263948 |
T |
|
| Q |
119 |
acccctttcgatcgaggcaacagaatttcagtagataaacaggagaagatgtggtgggtttctggacgtgataaaacgaggctacacaggggggacaaat |
218 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||| |
|
|
| T |
41263949 |
acccctttcgatcgaggcaacagaatttcagtagataaacaggagaagatgtggtgggtttctggacgagataaaacgaggctacacaggggggacaaat |
41264048 |
T |
|
| Q |
219 |
tg |
220 |
Q |
| |
|
|| |
|
|
| T |
41264049 |
tg |
41264050 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University