View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF21389_high_4 (Length: 349)
Name: NF21389_high_4
Description: NF21389
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF21389_high_4 |
 |  |
|
Alignment Details
Target: chr3 (Bit Score: 161; Significance: 8e-86; HSPs: 2)
Name: chr3
Description:
Target: chr3; HSP #1
Raw Score: 161; E-Value: 8e-86
Query Start/End: Original strand, 56 - 216
Target Start/End: Original strand, 50496889 - 50497049
Alignment:
| Q |
56 |
actatatgagttttttatttgaaagaagattgactgtacgagttattattgagtaaaataatttcttcctcaataatacgcatccctcactttagcttgg |
155 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
50496889 |
actatatgagttttttatttgaaagaagattgactgtacgagttattattgagtaaaataatttcttcctcaataatacgcatccctcactttagcttgg |
50496988 |
T |
 |
| Q |
156 |
tgtcgcccagattggatcctttgtgaatttaattttgcttgagattagataattcaactat |
216 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
50496989 |
tgtcgcccagattggatcctttgtgaatttaattttgcttgagattagataattcaactat |
50497049 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #2
Raw Score: 51; E-Value: 4e-20
Query Start/End: Original strand, 17 - 71
Target Start/End: Original strand, 50496694 - 50496748
Alignment:
| Q |
17 |
acacttttaatcaatattatttaatactttaaaattatgactatatgagtttttt |
71 |
Q |
| |
|
||||||||||| ||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
50496694 |
acacttttaattaatattatttaatactttaaaattatgactatatgagtttttt |
50496748 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University