View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF21389_low_5 (Length: 438)
Name: NF21389_low_5
Description: NF21389
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF21389_low_5 |
 | |
|
Alignment Details
Target: chr2 (Bit Score: 259; Significance: 1e-144; HSPs: 2)
Name: chr2
Description:
Target: chr2; HSP #1
Raw Score: 259; E-Value: 1e-144
Query Start/End: Original strand, 1 - 267
Target Start/End: Original strand, 7381046 - 7381312
Alignment:
| Q |
1 |
atgggaccagaaggacaataccatcttctcttacaagttcttgtctttgtctctctttcaactacccttttgggaattcccatgcaaaaaagcttcttgg |
100 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
7381046 |
atgggaccagaaggacaataccatcttctcttacaagttcttgtctttgtctctctttcaactacccttttgggaattcccatgcaaaaaagcttcttgg |
7381145 |
T |
|
| Q |
101 |
ttagttttgtgagatcattaagtatattttttcaaggcttgtggcttatggttatggggtacatgctttggacaccaagtttgattgccaaagggtgttt |
200 |
Q |
| |
|
|||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||| |
|
|
| T |
7381146 |
ttagttttgtaagatcattaagtatattttttcaaggcttgtggcttatggttatggggtacatgctttggacaccaagtttaattgccaaagggtgttt |
7381245 |
T |
|
| Q |
201 |
tatgaattctgaagaaggacataaagttgtgagatgttctgatgaagaatcacttcatcgtgctgtt |
267 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
7381246 |
tatgaattctgaagaaggacataaagttgtgagatgttctgatgaagaatcacttcatcgtgctgtt |
7381312 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #2
Raw Score: 142; E-Value: 2e-74
Query Start/End: Original strand, 276 - 421
Target Start/End: Complemental strand, 7380999 - 7380854
Alignment:
| Q |
276 |
gccatagaagctaggaattgtgttagggcaagttttgcttggttttcgattttgtcaaggattatggaggatgcggcgtaggcgaagaaagccatggaga |
375 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
7380999 |
gccatagaagctaggaattgtgttagggcaagttttgcttggttttcgattttgtcaaggattatggaggatgcggcgtaggcgaagaaagccatggaga |
7380900 |
T |
|
| Q |
376 |
tcaaagcgtgttcgaagttatgcagatgatatgaggggattgttcc |
421 |
Q |
| |
|
|||||||||||||||||||||| ||||||||||||||||||||||| |
|
|
| T |
7380899 |
tcaaagcgtgttcgaagttatggagatgatatgaggggattgttcc |
7380854 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University