View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF2138_high_24 (Length: 342)
Name: NF2138_high_24
Description: NF2138
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF2138_high_24 |
 | |
|
Alignment Details
Target: chr2 (Bit Score: 307; Significance: 1e-173; HSPs: 1)
Name: chr2
Description:
Target: chr2; HSP #1
Raw Score: 307; E-Value: 1e-173
Query Start/End: Original strand, 1 - 327
Target Start/End: Complemental strand, 37492909 - 37492583
Alignment:
| Q |
1 |
cgtatctccctcgcccaacttgtcattcgccaaaccaacgaaaccattcttttcgggttgctgctccaaatgctgaccgtggccggaactgctttcagtt |
100 |
Q |
| |
|
||||||||| |||||||||||||||||||||||||||||||||||||||||||| |||||||| ||||||||||||||| |||||||||||||||||||| |
|
|
| T |
37492909 |
cgtatctccttcgcccaacttgtcattcgccaaaccaacgaaaccattcttttcaggttgctgttccaaatgctgaccgcggccggaactgctttcagtt |
37492810 |
T |
|
| Q |
101 |
ttaggcaaagaactagtgctaggtgattcccaagcagcatttgatgaatttgcatcaaccaaatgtggccaaatcttagataactctgccaaagagggac |
200 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
37492809 |
ttaggcaaagaactagtgctaggtgattcccaagcagcatttgatgaatttgcatcaaccaaatgtggccaaatcttagataactctgccaaagagggac |
37492710 |
T |
|
| Q |
201 |
aaccagcgtagaaagtgagtagcacatgtttatgtcccaatacaaaacagtcatttgtattccaatcacaaacttgacagagagacaatttatgatcgac |
300 |
Q |
| |
|
|||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
37492709 |
aaccagtgtagaaagtgagtagcacatgtttatgtcccaatacaaaacagtcatttgtattccaatcacaaacttgacagagagacaatttatgatcgac |
37492610 |
T |
|
| Q |
301 |
gcagcgcacgattgctgagtcgaaatt |
327 |
Q |
| |
|
||||||||||||||||||||||||||| |
|
|
| T |
37492609 |
gcagcgcacgattgctgagtcgaaatt |
37492583 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University