View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF2138_high_28 (Length: 291)
Name: NF2138_high_28
Description: NF2138
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF2138_high_28 |
 | |
|
Alignment Details
Target: chr6 (Bit Score: 234; Significance: 1e-129; HSPs: 1)
Name: chr6
Description:
Target: chr6; HSP #1
Raw Score: 234; E-Value: 1e-129
Query Start/End: Original strand, 16 - 277
Target Start/End: Original strand, 20710736 - 20710997
Alignment:
| Q |
16 |
atgggtcttagttagtgagataagtgtactatcttatcagccttgtaaaggatttggcctcacttggcccctcaacagattgtgatagtcccctcttgaa |
115 |
Q |
| |
|
|||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||| |||||||||| |||||| |
|
|
| T |
20710736 |
atgggtcttagttagtgagatatgtgtactatcttatcagccttgtaaaggatttggcctcacttggcacctcaacagattgcgatagtccccccttgaa |
20710835 |
T |
|
| Q |
116 |
ggcaacctggaaaattccccaaccaagtaaagtgagaaactatgttttgagaatggctcgaaaaatcctccgtaccaaattaaaccttacgaagacgggt |
215 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||| |||||||||||||||||||||| |
|
|
| T |
20710836 |
ggcaacctggaaaattccccaaccaagtaaagtgagaaactatgttttgagaatggctcgaagaatcctccgtaccacattaaaccttacgaagacgggt |
20710935 |
T |
|
| Q |
216 |
attgcgctcgacactctttgccctctatgtaatgtggaggattaatctgctaaccatgtttt |
277 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||| |
|
|
| T |
20710936 |
attgcgctcgacactctttgccctctatgtaatgtggaggattaatctgccaaccatgtttt |
20710997 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University