View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF2138_high_44 (Length: 250)
Name: NF2138_high_44
Description: NF2138
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF2138_high_44 |
 | |
|
Alignment Details
Target: chr1 (Bit Score: 220; Significance: 1e-121; HSPs: 1)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 220; E-Value: 1e-121
Query Start/End: Original strand, 1 - 240
Target Start/End: Complemental strand, 45739920 - 45739681
Alignment:
| Q |
1 |
tttggtcaattttttaaattttgcatcgtagatgttatggtctagtcaaacatacacactagatctgaccgttataagcgtggttacattgttcagcgac |
100 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||| | |
|
|
| T |
45739920 |
tttggtcaattttttaaattttgcatcgtagatgttatggtctagtcaaacatacactctagatctgaccgttataagcgtggttacattgttcagcggc |
45739821 |
T |
|
| Q |
101 |
cgtagattcataaccgtattccatacctgtgtatgaaagttgctttgtaagtctcttgcattgatcaaaagtttcttggattgatcggatcataacttct |
200 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
45739820 |
cgtagattcataaccgtattccatacctgtgtatgaaagttgctttataagtctcttgcattgatcaaaagtttcttggattgatcggatcataacttct |
45739721 |
T |
|
| Q |
201 |
gatgacacaaaatctatcgtttgttacgacccgacctttg |
240 |
Q |
| |
|
|| |||||||||||||||||| |||||||||||||||||| |
|
|
| T |
45739720 |
gacgacacaaaatctatcgttggttacgacccgacctttg |
45739681 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University