View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF2138_high_49 (Length: 240)
Name: NF2138_high_49
Description: NF2138
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF2138_high_49 |
 |  |
|
| [»] chr1 (1 HSPs) |
 |  |
|
Alignment Details
Target: chr1 (Bit Score: 173; Significance: 4e-93; HSPs: 1)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 173; E-Value: 4e-93
Query Start/End: Original strand, 19 - 240
Target Start/End: Original strand, 39828677 - 39828897
Alignment:
| Q |
19 |
atcaccactggcttatcagctatatatcaatgcttctgctatatccattgctacaaaatatttcaaatttgtacctttttatatatgagtgacttgaag- |
117 |
Q |
| |
|
||||||||||||||||||||||| ||||||| || |||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
39828677 |
atcaccactggcttatcagctat----caatgctgctactatatacattgctacaaaatatttcaaatttgtacctttttatatatgagtgacttgaaga |
39828772 |
T |
 |
| Q |
118 |
attttctttgctattatgattaagttgagcacatgagaaggtctatttattgtagcttcatga--ggtggttttagaataatatttaaaacagaaaaaag |
215 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||| | |
|
|
| T |
39828773 |
attttctttgctattatgattaagttgagcacatgagaaggtctatttattgtagcttcatgatcggtggttttagaataatatttaaaacagaaaaagg |
39828872 |
T |
 |
| Q |
216 |
ttttaagagttgtcattggtggatt |
240 |
Q |
| |
|
||||||||||||||||||||||||| |
|
|
| T |
39828873 |
ttttaagagttgtcattggtggatt |
39828897 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University