View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF2138_high_54 (Length: 235)
Name: NF2138_high_54
Description: NF2138
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF2138_high_54 |
 |  |
|
Alignment Details
Target: chr7 (Bit Score: 201; Significance: 1e-110; HSPs: 2)
Name: chr7
Description:
Target: chr7; HSP #1
Raw Score: 201; E-Value: 1e-110
Query Start/End: Original strand, 1 - 217
Target Start/End: Original strand, 38830727 - 38830943
Alignment:
| Q |
1 |
cacaacaagaaatggtgttcgtgtgtggattggaacatttgatacagctgaagcagctgctttagcttatgaccaagcagctttcttaacacgaggatat |
100 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
38830727 |
cacaacaagaaatggtgttcgtgtgtggattggaacatttgatacagctgaagcagctgctttagcttatgaccaagcagctttcttaacacgaggatat |
38830826 |
T |
 |
| Q |
101 |
agggctatccttaacttctctgagcatgttgtgaaggagtctcttcaaaacatgaattttaatacattgttaaatcgtggttgctcacctttattggaac |
200 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||| ||||||||||||||||| |||| |
|
|
| T |
38830827 |
agggctatccttaacttctctgagcatgttgtgaaggagtctcttcaaaacatgaattttaagacattgttaaatcaaggttgctcacctttattagaac |
38830926 |
T |
 |
| Q |
201 |
taaaaaggatgcatgtg |
217 |
Q |
| |
|
||||||||||||||||| |
|
|
| T |
38830927 |
taaaaaggatgcatgtg |
38830943 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #2
Raw Score: 50; E-Value: 9e-20
Query Start/End: Original strand, 3 - 84
Target Start/End: Original strand, 38862450 - 38862531
Alignment:
| Q |
3 |
caacaagaaatggtgttcgtgtgtggattggaacatttgatacagctgaagcagctgctttagcttatgaccaagcagcttt |
84 |
Q |
| |
|
|||||||||| |||||| | ||||||||||||||||| || || || ||||||||||||||||||||||| ||||||||||| |
|
|
| T |
38862450 |
caacaagaaaaggtgttagagtgtggattggaacattcgacacggccgaagcagctgctttagcttatgatcaagcagcttt |
38862531 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1 (Bit Score: 56; Significance: 2e-23; HSPs: 4)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 56; E-Value: 2e-23
Query Start/End: Original strand, 3 - 98
Target Start/End: Complemental strand, 30623969 - 30623874
Alignment:
| Q |
3 |
caacaagaaatggtgttcgtgtgtggattggaacatttgatacagctgaagcagctgctttagcttatgaccaagcagctttcttaacacgaggat |
98 |
Q |
| |
|
|||||||||| |||||| | || |||||||| |||||||||||||||||||| ||||||||||||||||| ||||||||||| | |||| |||||| |
|
|
| T |
30623969 |
caacaagaaaaggtgttagagtttggattggtacatttgatacagctgaagctgctgctttagcttatgatcaagcagctttatcaacaagaggat |
30623874 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #2
Raw Score: 56; E-Value: 2e-23
Query Start/End: Original strand, 3 - 98
Target Start/End: Complemental strand, 30629600 - 30629505
Alignment:
| Q |
3 |
caacaagaaatggtgttcgtgtgtggattggaacatttgatacagctgaagcagctgctttagcttatgaccaagcagctttcttaacacgaggat |
98 |
Q |
| |
|
|||| |||||||||||| | || |||||||| ||||||||||||||||||||||| |||||||||||||| ||||||||||| | |||| |||||| |
|
|
| T |
30629600 |
caactagaaatggtgttagagtttggattggtacatttgatacagctgaagcagcagctttagcttatgatcaagcagctttatcaacaagaggat |
30629505 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #3
Raw Score: 29; E-Value: 0.0000003
Query Start/End: Original strand, 30 - 78
Target Start/End: Complemental strand, 30689781 - 30689733
Alignment:
| Q |
30 |
ttggaacatttgatacagctgaagcagctgctttagcttatgaccaagc |
78 |
Q |
| |
|
||||||||||||||| ||||||| ||||||||||||||||| ||||| |
|
|
| T |
30689781 |
ttggaacatttgatagtgctgaagatgctgctttagcttatgatcaagc |
30689733 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #4
Raw Score: 29; E-Value: 0.0000003
Query Start/End: Original strand, 30 - 78
Target Start/End: Complemental strand, 30718824 - 30718776
Alignment:
| Q |
30 |
ttggaacatttgatacagctgaagcagctgctttagcttatgaccaagc |
78 |
Q |
| |
|
||||||||||||||| ||||||| ||||||||||||||||| ||||| |
|
|
| T |
30718824 |
ttggaacatttgatagtgctgaagatgctgctttagcttatgatcaagc |
30718776 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2 (Bit Score: 31; Significance: 0.00000002; HSPs: 1)
Name: chr2
Description:
Target: chr2; HSP #1
Raw Score: 31; E-Value: 0.00000002
Query Start/End: Original strand, 30 - 72
Target Start/End: Complemental strand, 4420197 - 4420155
Alignment:
| Q |
30 |
ttggaacatttgatacagctgaagcagctgctttagcttatga |
72 |
Q |
| |
|
|||| |||||||||||||||||| |||||||||||||||||| |
|
|
| T |
4420197 |
ttggtacatttgatacagctgaacaagctgctttagcttatga |
4420155 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University