View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF2138_high_63 (Length: 202)
Name: NF2138_high_63
Description: NF2138
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF2138_high_63 |
 |  |
|
| [»] scaffold0007 (1 HSPs) |
 |  |
|
Alignment Details
Target: chr8 (Bit Score: 168; Significance: 3e-90; HSPs: 1)
Name: chr8
Description:
Target: chr8; HSP #1
Raw Score: 168; E-Value: 3e-90
Query Start/End: Original strand, 1 - 180
Target Start/End: Complemental strand, 30182286 - 30182107
Alignment:
| Q |
1 |
tttctatcttaatttcttaatattaagtatatgatagtatatattgtctttgtttgttgtgtagctatgtaaaatttgttaatgtcgaaattgatcttga |
100 |
Q |
| |
|
||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
30182286 |
tttctatcttaatttcttaatcttaagtatatgatagtatatattgtctttgtttgttgtgtagctatgtaaaatttgttaatgtcgaaattgatcttga |
30182187 |
T |
 |
| Q |
101 |
accatatggaccaaatcgatcacaatctgtatatattaggccagatacatcaacttttattgactcgactttttctaata |
180 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||| |||||||||||||| |
|
|
| T |
30182186 |
accatatggaccaaatcgatcacaatctgtatatattaggccagatacatcaacttttatttacttgactttttctaata |
30182107 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: scaffold0007 (Bit Score: 29; Significance: 0.0000003; HSPs: 1)
Name: scaffold0007
Description:
Target: scaffold0007; HSP #1
Raw Score: 29; E-Value: 0.0000003
Query Start/End: Original strand, 174 - 202
Target Start/End: Complemental strand, 77498 - 77470
Alignment:
| Q |
174 |
tctaatactccctccggtcctatttataa |
202 |
Q |
| |
|
||||||||||||||||||||||||||||| |
|
|
| T |
77498 |
tctaatactccctccggtcctatttataa |
77470 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University