View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF2138_low_18 (Length: 380)
Name: NF2138_low_18
Description: NF2138
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF2138_low_18 |
 |  |
|
Alignment Details
Target: chr7 (Bit Score: 270; Significance: 1e-151; HSPs: 2)
Name: chr7
Description:
Target: chr7; HSP #1
Raw Score: 270; E-Value: 1e-151
Query Start/End: Original strand, 73 - 370
Target Start/End: Complemental strand, 36601505 - 36601209
Alignment:
| Q |
73 |
ttttaggattgccatataatttgaattaagggttaatatgcctttagcggaatcttattctgctgttaataatgaattttacctatagtctgtgctaaca |
172 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||| ||||| |||||||||||||||||||||||||||||||||||||||||| |||||||| |
|
|
| T |
36601505 |
ttttaggattgccatataatttgaattaagggttaatatgcttttaggggaatcttattctgctgttaataatgaattttacctatagtccttgctaaca |
36601406 |
T |
 |
| Q |
173 |
attcacaagctagaatataaagttcttcgatgccctaataaaagccatcatttgaaaacaaaccacataccggctgtttagaatggcagttgtcaaacat |
272 |
Q |
| |
|
|||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||| |
|
|
| T |
36601405 |
attcacaagctagaatataaagttcttcgatgcc-taataaaagccatcatttgaaaacaaaccacataccggctgtttagaacggcagttgtcaaacat |
36601307 |
T |
 |
| Q |
273 |
gatgtttgtgtagcatgtcctgtctttgattgggttatagcacactgctgttttacatatcatctatctatccacattatgccgtaagtatctctgtg |
370 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
36601306 |
gatgtttgtgtagcatgtcctgtctttgattgggttatagcacactgctgttttacatatcatctatctatccacattatgccgtaagtatctctgtg |
36601209 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #2
Raw Score: 33; E-Value: 0.000000002
Query Start/End: Original strand, 19 - 59
Target Start/End: Complemental strand, 36601545 - 36601505
Alignment:
| Q |
19 |
attctaatcttaaatgtgtgacaataaagtagtattcactt |
59 |
Q |
| |
|
||||||||||| |||||||||||||||||||||| |||||| |
|
|
| T |
36601545 |
attctaatctttaatgtgtgacaataaagtagtagtcactt |
36601505 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University