View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF2138_low_28 (Length: 325)
Name: NF2138_low_28
Description: NF2138
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF2138_low_28 |
 |  |
|
Alignment Details
Target: chr1 (Bit Score: 167; Significance: 2e-89; HSPs: 1)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 167; E-Value: 2e-89
Query Start/End: Original strand, 119 - 309
Target Start/End: Original strand, 9950129 - 9950319
Alignment:
| Q |
119 |
caagggtaatcactaatccattttgctacaaatatttgtcccataacattcattattttcacctgtaaaacatagtaatacacaatacctagctagtatc |
218 |
Q |
| |
|
|||||||||||||| | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||| |
|
|
| T |
9950129 |
caagggtaatcacttagccattttgctacaaatatttgtcccataacattcattattttcacctgtaaaacatagtactacacaatacctagctagtatc |
9950228 |
T |
 |
| Q |
219 |
aaactcaaaacaatgcatattcaatttcaaacttgtcactcaattaagacacttccattaacatggaacattccaaaacccatcaaccacc |
309 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| || |||| ||||||| |
|
|
| T |
9950229 |
aaactcaaaacaatgcatattcaatttcaaacttgtcactcaattaagacacttccattaacatggaacattccagaatccattaaccacc |
9950319 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University