View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF2138_low_34 (Length: 282)
Name: NF2138_low_34
Description: NF2138
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF2138_low_34 |
 | |
|
| [»] chr2 (1 HSPs) |
| |
|
Alignment Details
Target: chr2 (Bit Score: 245; Significance: 1e-136; HSPs: 1)
Name: chr2
Description:
Target: chr2; HSP #1
Raw Score: 245; E-Value: 1e-136
Query Start/End: Original strand, 18 - 282
Target Start/End: Original strand, 4770641 - 4770905
Alignment:
| Q |
18 |
tcacttgcctgataacctcggctagtaaagttgctttgtccatctataagaatatcatcagcaccattaataacagtatgtacatatgcgaaactatgac |
117 |
Q |
| |
|
|||||||||| |||||||| ||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||| |
|
|
| T |
4770641 |
tcacttgcctaataacctcagctagtaaagttgctttgtccatctataagaatatcatcagcaacattaataacagtatgtacatatgcgaaactatgac |
4770740 |
T |
|
| Q |
118 |
acattgacaccgaaatggacatcgtaaatgacacatagacatcactaggtcgtatatcctgtcttattaaatgtattgtttttgttttaaggattattaa |
217 |
Q |
| |
|
||||||||||||||||||||||| ||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
4770741 |
acattgacaccgaaatggacatcataaataacacatagacatcactaggtcgtatatcctgtcttattaaatgtattgtttttgttttaaggattattaa |
4770840 |
T |
|
| Q |
218 |
atggttggttgcctaattccttcatcattggtcaggtaaagttattttctagacttagacccacc |
282 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
4770841 |
atggttggttgcctaattccttcatcattggtcaggtaaagttattttctagacttagacccacc |
4770905 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University