View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF2138_low_35 (Length: 275)
Name: NF2138_low_35
Description: NF2138
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF2138_low_35 |
 | |
|
Alignment Details
Target: chr8 (Bit Score: 117; Significance: 1e-59; HSPs: 2)
Name: chr8
Description:
Target: chr8; HSP #1
Raw Score: 117; E-Value: 1e-59
Query Start/End: Original strand, 16 - 161
Target Start/End: Original strand, 16072443 - 16072588
Alignment:
| Q |
16 |
ttatgcagcaactgattcaacaatctagtcacatgaagtttatccaannnnnnngttattgctatgatctctctcaaccaatctttaatctttttcacca |
115 |
Q |
| |
|
|||||||| |||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
16072443 |
ttatgcagaaactgattcaacaatctagtcacatgaagtttatccaatttttttgttattgctatgatctctctcaaccaatctttaatctttttcacca |
16072542 |
T |
|
| Q |
116 |
tgtcacggttgaggctcgctcgaaaacaaagaagttgccaccaatg |
161 |
Q |
| |
|
||||||||||||||||| |||||||||||||||||||||||||||| |
|
|
| T |
16072543 |
tgtcacggttgaggctccctcgaaaacaaagaagttgccaccaatg |
16072588 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #2
Raw Score: 45; E-Value: 1e-16
Query Start/End: Original strand, 215 - 259
Target Start/End: Original strand, 16072641 - 16072685
Alignment:
| Q |
215 |
ctagacattaggttatggatttgattatgcgtacggtgtgtatta |
259 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
16072641 |
ctagacattaggttatggatttgattatgcgtacggtgtgtatta |
16072685 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University