View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF2138_low_37 (Length: 269)
Name: NF2138_low_37
Description: NF2138
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF2138_low_37 |
 |  |
|
| [»] chr2 (2 HSPs) |
 |  |
|
Alignment Details
Target: chr2 (Bit Score: 125; Significance: 2e-64; HSPs: 2)
Name: chr2
Description:
Target: chr2; HSP #1
Raw Score: 125; E-Value: 2e-64
Query Start/End: Original strand, 145 - 269
Target Start/End: Complemental strand, 37493046 - 37492922
Alignment:
| Q |
145 |
gattagaacgaaatcaaaaccttctgttggtttgagtcttgattaaataaaaatggttgatctttgtagtattgtgtgcagtttgaatttgatggaataa |
244 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
37493046 |
gattagaacgaaatcaaaaccttctgttggtttgagtcttgattaaataaaaatggttgatctttgtagtattgtgtgcagtttgaatttgatggaataa |
37492947 |
T |
 |
| Q |
245 |
taggagaattttcaatccaaggttc |
269 |
Q |
| |
|
||||||||||||||||||||||||| |
|
|
| T |
37492946 |
taggagaattttcaatccaaggttc |
37492922 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #2
Raw Score: 69; E-Value: 5e-31
Query Start/End: Original strand, 14 - 86
Target Start/End: Complemental strand, 37493177 - 37493105
Alignment:
| Q |
14 |
cataggcacactggaaaagttttgccgccttatgtgcgtccacccggctcggatagtaacgagggtctagacc |
86 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||| |
|
|
| T |
37493177 |
cataggcacactggaaaagttttgccgccttatgtgcgtccacccggctcggagagtaacgagggtctagacc |
37493105 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University