View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF2138_low_42 (Length: 254)
Name: NF2138_low_42
Description: NF2138
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF2138_low_42 |
 |  |
|
Alignment Details
Target: chr7 (Bit Score: 168; Significance: 4e-90; HSPs: 1)
Name: chr7
Description:
Target: chr7; HSP #1
Raw Score: 168; E-Value: 4e-90
Query Start/End: Original strand, 13 - 200
Target Start/End: Original strand, 12307256 - 12307443
Alignment:
| Q |
13 |
gagatgaacgccacaagtgcaacccatcgctgatcggcaaccagctcccacattcgtcggagagcaagcaatgcgggcatgggttcagcacggttttctt |
112 |
Q |
| |
|
|||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||| |
|
|
| T |
12307256 |
gagacgaacgccacaagtgcaacccatcgctgatcggcaaccagctcccacattcgtcggagagcaagcaatgcgggcatgggttcagcacggtcttctt |
12307355 |
T |
 |
| Q |
113 |
ccggatgtttgggtagcgtccaccaatcgccaccgggtaaaattgaggcagcgaatgcaggccgtttgaggagaatgttgtggaaggt |
200 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||| |||||||| ||||||||||||||||||| |
|
|
| T |
12307356 |
ccggatgtttgggtagcgtccaccaatcgccaccgggtaaagttgaggcagcgaatgcaagccgtttggggagaatgttgtggaaggt |
12307443 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University