View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF2138_low_43 (Length: 253)
Name: NF2138_low_43
Description: NF2138
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF2138_low_43 |
 | |
|
Alignment Details
Target: chr4 (Bit Score: 180; Significance: 3e-97; HSPs: 1)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 180; E-Value: 3e-97
Query Start/End: Original strand, 22 - 237
Target Start/End: Complemental strand, 46407335 - 46407119
Alignment:
| Q |
22 |
ttctatgtcccaaattatgcggtgaatgaaaagccacgtgcaattttgaacctacaactcgtgtctgctacctgccagtgattgattgctttactttttc |
121 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
46407335 |
ttctatgtcccaaattatgcggtgaatgaaaagccacgtgcaattttaaacctacaactcgtgtctgctacctgccagtgattgattgctttactttttc |
46407236 |
T |
|
| Q |
122 |
atatatctgaaatcagatatcacg-----atccttctgaccttagttagtagtaacgtttgaaagtgaaatttactgcctcccaacgctctttctctctc |
216 |
Q |
| |
|
|||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||| |
|
|
| T |
46407235 |
atatatctgaaatcagatatcacgatctcatccttctgaccttagttagtagtaacgtttgaaagtgaaatttactgcctcccaacgctctt----tctc |
46407140 |
T |
|
| Q |
217 |
gcaccccccaaaatcactttt |
237 |
Q |
| |
|
||||||||||||||||||||| |
|
|
| T |
46407139 |
gcaccccccaaaatcactttt |
46407119 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University