View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF2138_low_46 (Length: 250)
Name: NF2138_low_46
Description: NF2138
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF2138_low_46 |
 | |
|
Alignment Details
Target: chr1 (Bit Score: 162; Significance: 1e-86; HSPs: 2)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 162; E-Value: 1e-86
Query Start/End: Original strand, 42 - 237
Target Start/End: Complemental strand, 6220629 - 6220442
Alignment:
| Q |
42 |
acactgtatcaatgttgttaaatggaacagagagaaataataagggtaattaataacagttaaaaatggttgtggtacataatgcataatatatcatgtg |
141 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||| ||||||| |
|
|
| T |
6220629 |
acactgtatcaatgttgttaaatggaacagagagaaataataagggt---taataacagttaaaaatggttgtggtacataatgcata-----tcatgtg |
6220538 |
T |
|
| Q |
142 |
ttaaatgagacaattcactgaaaatacaacttttgccattgacttgtcagcatgtatatggctttattatcctggaactttgccagccctttttct |
237 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
6220537 |
ttaaatgagacaattcactgaaaatacaacttttgccattgacttgtcagcatgtatatggctttattatcctggaactttgccagccctttttct |
6220442 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #2
Raw Score: 45; E-Value: 9e-17
Query Start/End: Original strand, 1 - 45
Target Start/End: Complemental strand, 6220717 - 6220673
Alignment:
| Q |
1 |
cattccaacaattgctaattgctatagcgagtgaacaacctacac |
45 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
6220717 |
cattccaacaattgctaattgctatagcgagtgaacaacctacac |
6220673 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University