View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF2138_low_51 (Length: 242)
Name: NF2138_low_51
Description: NF2138
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF2138_low_51 |
 | |
|
Alignment Details
Target: chr7 (Bit Score: 166; Significance: 6e-89; HSPs: 1)
Name: chr7
Description:
Target: chr7; HSP #1
Raw Score: 166; E-Value: 6e-89
Query Start/End: Original strand, 1 - 224
Target Start/End: Complemental strand, 40846779 - 40846559
Alignment:
| Q |
1 |
ccaatattggattgtaacttactgctgcaaagtgcaaacctaacaatgcaggtaaaacgaatcagctgacaagattataaagttgcgttgnnnnnnn-aa |
99 |
Q |
| |
|
|||||||||| |||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| || |
|
|
| T |
40846779 |
ccaatattggcttgtaacttactactgcaaagtgcaaacctaacaatgcaggtaaaacgaatcagctgacaagattataaagttgcgttgttttttttaa |
40846680 |
T |
|
| Q |
100 |
gctgttggatataattattacacagtctagattacaacttcttcaaaccattgactttatttttataagcataatttttattgaaagagactaaactagc |
199 |
Q |
| |
|
||||||||||| ||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
40846679 |
gctgttggata--attattaca--gtctagattacaacttcttcaaaccattgactttatttttataagcataatttttattgaaagagactaaactagc |
40846584 |
T |
|
| Q |
200 |
acaagatgtgcaaagtagctctaag |
224 |
Q |
| |
|
||||||||||||||||||||||||| |
|
|
| T |
40846583 |
acaagatgtgcaaagtagctctaag |
40846559 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University