View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF21390_high_10 (Length: 403)
Name: NF21390_high_10
Description: NF21390
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF21390_high_10 |
 | |
|
Alignment Details
Target: chr5 (Bit Score: 71; Significance: 5e-32; HSPs: 1)
Name: chr5
Description:
Target: chr5; HSP #1
Raw Score: 71; E-Value: 5e-32
Query Start/End: Original strand, 19 - 97
Target Start/End: Original strand, 30857296 - 30857374
Alignment:
| Q |
19 |
acaatcctacttcaaaatcgagtaaatatatagtagcttattctccaagactcacatgtctacatcagaatggacaaaa |
97 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||| |||||| |
|
|
| T |
30857296 |
acaatcctacttcaaaatcgagtaaatatatagtagcttattctccaagactcacatgtccacatcagaatgaacaaaa |
30857374 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University