View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF21390_high_15 (Length: 306)
Name: NF21390_high_15
Description: NF21390
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF21390_high_15 |
 |  |
|
Alignment Details
Target: chr1 (Bit Score: 170; Significance: 3e-91; HSPs: 3)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 170; E-Value: 3e-91
Query Start/End: Original strand, 1 - 182
Target Start/End: Complemental strand, 14250015 - 14249834
Alignment:
| Q |
1 |
gctctatgggtgaagcttccgcggcgaggttagggaattatcttcctggtcatctgaatttgttggcttcattgtctggtgggaatggaaattctggtcg |
100 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
14250015 |
gctctatgggtgaagcttccgcggcgaggttagggaattatcttcctggtcatctgaatttgttggcttcattgtctggtgggaatggaaattctggtcg |
14249916 |
T |
 |
| Q |
101 |
tggagatgatgaagatcgttgaaccggggaattccgtgttttctactttattcatgtttttagtatatatagatatgaatta |
182 |
Q |
| |
|
||||||||||||||||||||||| |||||||||| ||||||| ||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
14249915 |
tggagatgatgaagatcgttgaaacggggaattcggtgttttgtactttattcatgtttttagtatatatagatatgaatta |
14249834 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #2
Raw Score: 58; E-Value: 2e-24
Query Start/End: Original strand, 236 - 297
Target Start/End: Complemental strand, 14249782 - 14249721
Alignment:
| Q |
236 |
aagtagaatatttgttagtcaaattagggttaggttattgttatttttgagtgatgatgtcc |
297 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||| |
|
|
| T |
14249782 |
aagtagaatatttgttagtcaaattagggttaggttattgttatttttgagtgatgaagtcc |
14249721 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #3
Raw Score: 55; E-Value: 1e-22
Query Start/End: Original strand, 4 - 122
Target Start/End: Original strand, 51615349 - 51615467
Alignment:
| Q |
4 |
ctatgggtgaagcttccgcggcgaggttagggaattatcttcctggtcatctgaatttgttggcttcattgtctggtgggaatggaaattctggtcgtgg |
103 |
Q |
| |
|
|||||||||||||||| || || || | ||||||||||||||||||||||| |||||| | ||||| ||||||||||| |||||||||||||||| | |
|
|
| T |
51615349 |
ctatgggtgaagcttcagctgctagagttgggaattatcttcctggtcatctcaatttgcttgcttcgttgtctggtggacatggaaattctggtcggag |
51615448 |
T |
 |
| Q |
104 |
agatgatgaagatcgttga |
122 |
Q |
| |
|
|||||||||| ||| |||| |
|
|
| T |
51615449 |
agatgatgaacatcattga |
51615467 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University