View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF21390_high_25 (Length: 242)
Name: NF21390_high_25
Description: NF21390
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF21390_high_25 |
 |  |
|
Alignment Details
Target: chr2 (Bit Score: 141; Significance: 5e-74; HSPs: 2)
Name: chr2
Description:
Target: chr2; HSP #1
Raw Score: 141; E-Value: 5e-74
Query Start/End: Original strand, 93 - 233
Target Start/End: Original strand, 7381339 - 7381479
Alignment:
| Q |
93 |
gttagttattgttgttgccgtttttggtgtttctttgtatttggttttgaccaaatattatggtgcaaataaagttcggtatttctcgttggggattgag |
192 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
7381339 |
gttagttattgttgttgccgtttttggtgtttctttgtatttggttttgaccaaatattatggtgcaaataaagttcggtatttctcgttggggattgag |
7381438 |
T |
 |
| Q |
193 |
gatgaagagagagaagatgttgaaaagttaagtgatgatgt |
233 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
7381439 |
gatgaagagagagaagatgttgaaaagttaagtgatgatgt |
7381479 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #2
Raw Score: 76; E-Value: 3e-35
Query Start/End: Original strand, 1 - 97
Target Start/End: Complemental strand, 7381070 - 7380974
Alignment:
| Q |
1 |
gatggtattgtccttctggtcccatgtgatcagctgaatgaagatggaagagaagaagctgttgnnnnnnngccatagaagctaggaattgtgttag |
97 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||| |
|
|
| T |
7381070 |
gatggtattgtccttctggtcccatgtgatcagctgaatgaagatggaagagaagaagctgttgaaaaaaagccatagaagctaggaattgtgttag |
7380974 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University