View Alignment

This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.

Legend
 Query
 Query hiting target  Query hiting target's complemental strand
 Query's complemental strand hiting target  Query's complemental strand hiting target's complemental strand

Alignment Overview

Query: NF21390_high_25 (Length: 242)

Name: NF21390_high_25
Description: NF21390
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)


[»] NF21390_high_25
NF21390_high_25
[»] chr2 (2 HSPs)
chr2 (93-233)||(7381339-7381479)
chr2 (1-97)||(7380974-7381070)


Alignment Details
Target: chr2 (Bit Score: 141; Significance: 5e-74; HSPs: 2)
Name: chr2
Description:

Target: chr2; HSP #1
Raw Score: 141; E-Value: 5e-74
Query Start/End: Original strand, 93 - 233
Target Start/End: Original strand, 7381339 - 7381479
Alignment:
93 gttagttattgttgttgccgtttttggtgtttctttgtatttggttttgaccaaatattatggtgcaaataaagttcggtatttctcgttggggattgag 192  Q
    ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||    
7381339 gttagttattgttgttgccgtttttggtgtttctttgtatttggttttgaccaaatattatggtgcaaataaagttcggtatttctcgttggggattgag 7381438  T
193 gatgaagagagagaagatgttgaaaagttaagtgatgatgt 233  Q
    |||||||||||||||||||||||||||||||||||||||||    
7381439 gatgaagagagagaagatgttgaaaagttaagtgatgatgt 7381479  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr2; HSP #2
Raw Score: 76; E-Value: 3e-35
Query Start/End: Original strand, 1 - 97
Target Start/End: Complemental strand, 7381070 - 7380974
Alignment:
1 gatggtattgtccttctggtcccatgtgatcagctgaatgaagatggaagagaagaagctgttgnnnnnnngccatagaagctaggaattgtgttag 97  Q
    ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||       ||||||||||||||||||||||||||    
7381070 gatggtattgtccttctggtcccatgtgatcagctgaatgaagatggaagagaagaagctgttgaaaaaaagccatagaagctaggaattgtgttag 7380974  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]



© Oklahoma State University