View Alignment

This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.

Legend
 Query
 Query hiting target  Query hiting target's complemental strand
 Query's complemental strand hiting target  Query's complemental strand hiting target's complemental strand

Alignment Overview

Query: NF21390_high_28 (Length: 234)

Name: NF21390_high_28
Description: NF21390
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)


[»] NF21390_high_28
NF21390_high_28
[»] chr2 (1 HSPs)
chr2 (1-217)||(7380854-7381070)


Alignment Details
Target: chr2 (Bit Score: 192; Significance: 1e-104; HSPs: 1)
Name: chr2
Description:

Target: chr2; HSP #1
Raw Score: 192; E-Value: 1e-104
Query Start/End: Original strand, 1 - 217
Target Start/End: Complemental strand, 7381070 - 7380854
Alignment:
1 gatggtattgtccttctggtcccatgtgatcagctgaatgaagatggaagagaagaagctgttgnnnnnnngccatagaagctaggaattgtgttagggc 100  Q
    ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||       |||||||||||||||||||||||||||||    
7381070 gatggtattgtccttctggtcccatgtgatcagctgaatgaagatggaagagaagaagctgttgaaaaaaagccatagaagctaggaattgtgttagggc 7380971  T
101 aagttttgcttggttttcgattttgtcaaggattatggaggatgcggcgtaggcgaagaaagccatggagatcaaagcgtgttcgaagttatgcagatga 200  Q
    ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||    
7380970 aagttttgcttggttttcgattttgtcaaggattatggaggatgcggcgtaggcgaagaaagccatggagatcaaagcgtgttcgaagttatggagatga 7380871  T
201 tatgaggggattgttcc 217  Q
    |||||||||||||||||    
7380870 tatgaggggattgttcc 7380854  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]



© Oklahoma State University