View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF21390_high_29 (Length: 211)
Name: NF21390_high_29
Description: NF21390
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF21390_high_29 |
 |  |
|
Alignment Details
Target: chr2 (Bit Score: 109; Significance: 5e-55; HSPs: 2)
Name: chr2
Description:
Target: chr2; HSP #1
Raw Score: 109; E-Value: 5e-55
Query Start/End: Original strand, 1 - 109
Target Start/End: Original strand, 7381046 - 7381154
Alignment:
| Q |
1 |
atgggaccagaaggacaataccatcttctcttacaagttcttgtctttgtctctctttcaactacccttttgggaattcccatgcaaaaaagcttcttgg |
100 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
7381046 |
atgggaccagaaggacaataccatcttctcttacaagttcttgtctttgtctctctttcaactacccttttgggaattcccatgcaaaaaagcttcttgg |
7381145 |
T |
 |
| Q |
101 |
ttagttttg |
109 |
Q |
| |
|
||||||||| |
|
|
| T |
7381146 |
ttagttttg |
7381154 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #2
Raw Score: 105; E-Value: 1e-52
Query Start/End: Original strand, 103 - 211
Target Start/End: Complemental strand, 7380969 - 7380861
Alignment:
| Q |
103 |
agttttgcttggttttcgattttgtcaaggattatggaggatgcggcgtaggcgaagaaagccatggagatcaaagcgtgttcgaagttatgcagatgat |
202 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||| |
|
|
| T |
7380969 |
agttttgcttggttttcgattttgtcaaggattatggaggatgcggcgtaggcgaagaaagccatggagatcaaagcgtgttcgaagttatggagatgat |
7380870 |
T |
 |
| Q |
203 |
atgagggga |
211 |
Q |
| |
|
||||||||| |
|
|
| T |
7380869 |
atgagggga |
7380861 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University