View Alignment

This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.

Legend
 Query
 Query hiting target  Query hiting target's complemental strand
 Query's complemental strand hiting target  Query's complemental strand hiting target's complemental strand

Alignment Overview

Query: NF21390_high_29 (Length: 211)

Name: NF21390_high_29
Description: NF21390
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)


[»] NF21390_high_29
NF21390_high_29
[»] chr2 (2 HSPs)
chr2 (1-109)||(7381046-7381154)
chr2 (103-211)||(7380861-7380969)


Alignment Details
Target: chr2 (Bit Score: 109; Significance: 5e-55; HSPs: 2)
Name: chr2
Description:

Target: chr2; HSP #1
Raw Score: 109; E-Value: 5e-55
Query Start/End: Original strand, 1 - 109
Target Start/End: Original strand, 7381046 - 7381154
Alignment:
1 atgggaccagaaggacaataccatcttctcttacaagttcttgtctttgtctctctttcaactacccttttgggaattcccatgcaaaaaagcttcttgg 100  Q
    ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||    
7381046 atgggaccagaaggacaataccatcttctcttacaagttcttgtctttgtctctctttcaactacccttttgggaattcccatgcaaaaaagcttcttgg 7381145  T
101 ttagttttg 109  Q
    |||||||||    
7381146 ttagttttg 7381154  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr2; HSP #2
Raw Score: 105; E-Value: 1e-52
Query Start/End: Original strand, 103 - 211
Target Start/End: Complemental strand, 7380969 - 7380861
Alignment:
103 agttttgcttggttttcgattttgtcaaggattatggaggatgcggcgtaggcgaagaaagccatggagatcaaagcgtgttcgaagttatgcagatgat 202  Q
    |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||    
7380969 agttttgcttggttttcgattttgtcaaggattatggaggatgcggcgtaggcgaagaaagccatggagatcaaagcgtgttcgaagttatggagatgat 7380870  T
203 atgagggga 211  Q
    |||||||||    
7380869 atgagggga 7380861  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]



© Oklahoma State University