View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF21390_low_17 (Length: 299)
Name: NF21390_low_17
Description: NF21390
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF21390_low_17 |
 | |
|
Alignment Details
Target: chr5 (Bit Score: 111; Significance: 5e-56; HSPs: 2)
Name: chr5
Description:
Target: chr5; HSP #1
Raw Score: 111; E-Value: 5e-56
Query Start/End: Original strand, 163 - 281
Target Start/End: Complemental strand, 12818810 - 12818692
Alignment:
| Q |
163 |
atcacttcaaaaccctaatttattaaaaccaaccaagaatttcacttcacttcttggaaatcctaaacttctctttctctcaattatttcttctccgaaa |
262 |
Q |
| |
|
||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||| |
|
|
| T |
12818810 |
atcacttcaaaaccctaatttattataaccaaccaagaatttcacttcacttcttggaaatcctaaacttctctttctctcaattatttcttcttcgaaa |
12818711 |
T |
|
| Q |
263 |
ccctaactttcaaaatttc |
281 |
Q |
| |
|
||||||||||||||||||| |
|
|
| T |
12818710 |
ccctaactttcaaaatttc |
12818692 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #2
Raw Score: 30; E-Value: 0.0000001
Query Start/End: Original strand, 23 - 52
Target Start/End: Complemental strand, 12818950 - 12818921
Alignment:
| Q |
23 |
cagagagagaaagagaaagagcgcgatgtc |
52 |
Q |
| |
|
|||||||||||||||||||||||||||||| |
|
|
| T |
12818950 |
cagagagagaaagagaaagagcgcgatgtc |
12818921 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University