View Alignment

This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.

Legend
 Query
 Query hiting target  Query hiting target's complemental strand
 Query's complemental strand hiting target  Query's complemental strand hiting target's complemental strand

Alignment Overview

Query: NF21390_low_17 (Length: 299)

Name: NF21390_low_17
Description: NF21390
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)


[»] NF21390_low_17
NF21390_low_17
[»] chr5 (2 HSPs)
chr5 (163-281)||(12818692-12818810)
chr5 (23-52)||(12818921-12818950)


Alignment Details
Target: chr5 (Bit Score: 111; Significance: 5e-56; HSPs: 2)
Name: chr5
Description:

Target: chr5; HSP #1
Raw Score: 111; E-Value: 5e-56
Query Start/End: Original strand, 163 - 281
Target Start/End: Complemental strand, 12818810 - 12818692
Alignment:
163 atcacttcaaaaccctaatttattaaaaccaaccaagaatttcacttcacttcttggaaatcctaaacttctctttctctcaattatttcttctccgaaa 262  Q
    ||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||    
12818810 atcacttcaaaaccctaatttattataaccaaccaagaatttcacttcacttcttggaaatcctaaacttctctttctctcaattatttcttcttcgaaa 12818711  T
263 ccctaactttcaaaatttc 281  Q
    |||||||||||||||||||    
12818710 ccctaactttcaaaatttc 12818692  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr5; HSP #2
Raw Score: 30; E-Value: 0.0000001
Query Start/End: Original strand, 23 - 52
Target Start/End: Complemental strand, 12818950 - 12818921
Alignment:
23 cagagagagaaagagaaagagcgcgatgtc 52  Q
    ||||||||||||||||||||||||||||||    
12818950 cagagagagaaagagaaagagcgcgatgtc 12818921  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]



© Oklahoma State University