View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF21391_high_8 (Length: 426)
Name: NF21391_high_8
Description: NF21391
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF21391_high_8 |
 |  |
|
Alignment Details
Target: chr4 (Bit Score: 135; Significance: 3e-70; HSPs: 1)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 135; E-Value: 3e-70
Query Start/End: Original strand, 257 - 411
Target Start/End: Complemental strand, 26437965 - 26437811
Alignment:
| Q |
257 |
aaaattatacattgccaaaagttagcttccagccaaatccagcattttcaaggggttggattagcaatcagcatcaaataattagaagaaaaatcgcaac |
356 |
Q |
| |
|
||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||| |
|
|
| T |
26437965 |
aaaattatacattgccaaaagttagcttccagcgaaatccagcattttcaaggggttggattagcaatcaccatcaaataattagaagaaaaatcgcaac |
26437866 |
T |
 |
| Q |
357 |
gagcacaaaagcagtatcagatatgagaaagttgttgtaatttaaacgttgttca |
411 |
Q |
| |
|
|||||||| |||| |||||||| |||||||||||||||||||||||||||||||| |
|
|
| T |
26437865 |
gagcacaacagcaatatcagatgtgagaaagttgttgtaatttaaacgttgttca |
26437811 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University