View Alignment

This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.

Legend
 Query
 Query hiting target  Query hiting target's complemental strand
 Query's complemental strand hiting target  Query's complemental strand hiting target's complemental strand

Alignment Overview

Query: NF21391_low_12 (Length: 302)

Name: NF21391_low_12
Description: NF21391
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)


[»] NF21391_low_12
NF21391_low_12
[»] chr3 (1 HSPs)
chr3 (9-286)||(44473530-44473807)


Alignment Details
Target: chr3 (Bit Score: 278; Significance: 1e-155; HSPs: 1)
Name: chr3
Description:

Target: chr3; HSP #1
Raw Score: 278; E-Value: 1e-155
Query Start/End: Original strand, 9 - 286
Target Start/End: Original strand, 44473530 - 44473807
Alignment:
9 agcagagatccgtacaactttcttctcgtgcccaaaaacttgaagtggcacctgaaacattacagacaagtgaataaaatatcgcaaacaagaaaatgct 108  Q
    ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||    
44473530 agcagagatccgtacaactttcttctcgtgcccaaaaacttgaagtggcacctgaaacattacagacaagtgaataaaatatcgcaaacaagaaaatgct 44473629  T
109 ggcaagtaatgcactcatgaacattagagcaaaagaacaagatgttgcaattgtcatcagtttacttgacaaaaatacaggaaaaaaggcaaagtaatca 208  Q
    ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||    
44473630 ggcaagtaatgcactcatgaacattagagcaaaagaacaagatgttgcaattgtcatcagtttacttgacaaaaatacaggaaaaaaggcaaagtaatca 44473729  T
209 tacaactgagtagggtttactctccgatgtaccgagctgtccaaaatcattgagaccagtagcataaacacatccatt 286  Q
    ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||    
44473730 tacaactgagtagggtttactctccgatgtaccgagctgtccaaaatcattgagaccagtagcataaacacatccatt 44473807  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]



© Oklahoma State University